Будь умным!


У вас вопросы?
У нас ответы:) SamZan.ru

Strtаgene США и BL21DE3 Novgene СШ

Работа добавлена на сайт samzan.ru: 2015-07-05

Поможем написать учебную работу

Если у вас возникли сложности с курсовой, контрольной, дипломной, рефератом, отчетом по практике, научно-исследовательской и любой другой работой - мы готовы помочь.

Предоплата всего

от 25%

Подписываем

договор

Выберите тип работы:

Скидка 25% при заказе до 23.1.2022

Методика

Клеточные линии и питательные среды для роста клеток.

В работе были использованы штаммы Magnetospirillum magnetotacticum MS-1 и Staphylococcus aureus, из Всероссийской Коллекции Промышленных Микроорганизмов (ВКПМ), штаммы Escherichia coli XL-1 Blue  «Stratаgene» (США) и BL21(DE3) «Novagene» (СШA). Для генно-инженерных работ использовали вектор pET-23a(+) «Novagene» (СШA).

Бактериальные клетки E. coli выращивали в питательных средах LB (Luria-Bertani) и TB (Terrific Broth) в зависимости от поставленной задачи. Для трансформации использовали питательную среду SOB. Для выделения плазмидной ДНК биомассу клеток наращивали в питательной среде. На заключительном этапе экспрессию рекомбинантных белков осуществляли в питательной среде TB. Твердую среду для выращивания одиночных клонов E. coli на чашках Петри получали добавлением к LB 2% (масса/объем) агара. При селективном выращивании в среду добавляли ампициллин до конечной концентрации 100 мкг/мл.

Для выделения ДНК применяли методику, основанную на модифицированном методе щелочного выделения ДНК Бирнбойма-Доли (Birnboim a. Doly, 1979) и Wizard-технологии фирмы «Promega» (США). Очищенную ДНК хранили в холодильнике при -18оС. Концентрация ДНК в получаемых препаратах составляла 10-100 мкг/мл. РНК в препаратах присутствовала в следовых количествах – менее 1%, согласно данным электрофоретического анализа.

Получение генетических конструкций

Генетические конструкции получали методом ПЦР. Амплификацию проводили с использованием разработанных праймеров (Табл. 1).

Таблица 1. Праймеры используемые в ПЦР

Название

5'

Нуклеотидная последовательность

3'

Длина пн

2MGSr

5'

TCCACTTCCACTTCCGGCCAGTTCGTCCCGCAAGATGT

3'

37

3BR

5'

TTTTGGTGCTTGTGCATCATTTAGC

3'

25

1BF

5'

GATAACAAATTCAACAAAGA

3'

20

2MSF

5'

GGGCATATGCCCTTTCACCTTGCCCC

3'

26

2SpR

5'

GGGCATATGCCCTTTCACCTTGCCCC

3'

26

GSBf

5'

GGAAGTGGAAGTGGAGATAACAAATTCAACAAAGAAC

3'

36

T7F

5'

TAATACGACTCACTATAGG

3'

19

T7R

5'

GCTAGTTATTGCTCAGCGG

3'

19

Анализ продуктов ПЦР проводили при помощи электрофореза в 1% агарозном геле, при напряженности поля 6 В/см и документировали с помощью системы BioDoc Analyze (Biometra, Германия) по свечению бромистого этидия. Очистка ПЦР-фрагментов.

Реакцию рестрикции проводили, используя эндонуклеазы рестрикции Xho и Nde I (Fermentas, Литва). Реакцию лигирования проводили, используя ДНК лигазу фага Т4. Реакцию фосфорилирования проводили, используя ДНК- полинуклеотидкиназу фага Т4 (Fermentas, Литва). Плазмидную ДНК выделяли из культуры клеток E. coli XL-1 Blue, BL21(DE3), выращенной в жидкой среде LB в течение ночи при 37С. Выделение плазмидной ДНК проводили с применением набора реактивов «Wizard MiniPreps» (Promega, США).

Секвенирование ДНК проводили с использованием набора реактивов BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, США). Нуклеотидные последовательности определяли на автоматических секвенаторах  ABI 3730 (Applied Biosystems, США). Плазмиды со вставкой секвенировали с применением плазмидных праймеров  T7F , T7R .

 Экспрессию гибридных белков проводили методом автоиндукции (Studier 2005). Концентрацию белков в растворе определяли по методу, предложенному Бредфордом. Концентрации высчитывались исходя из калибровочной кривой для бычьего сывороточного альбумина.

Выделение суммарного белка из клеток E. coli.

Центрифугировали 1 мл культуральной среды при 12000g в течение 3 минут. Суспендировали клетки в 100 мкл TES-буфера (10мМ Tris-HCl, pH 6.8; 1 мМ ЭДТА, 1% SDS). Лизировали клетки нагреванием при 100 С в течение 5 минут. Нерастворимые частицы  осаждали центрифугированием в течение 5 минут при  12000g.

 Выделение фракции растворимых клеточных белков E. coli.

Центрифугировали 1 мл культуральной среды при 12000g в течение 3 минут. Клетки суспендировали в 50 мкл сферопластного буфера (100 мМ Трис-НСl, рН 8.0, 0.5 М сахароза, 0.5 мМ ЕDТА). Добавляли PMSF до конечной концентрации 0.1 мМ и 2,5 мкл лизоцима (2мг/мл), растворенного в том же буфере. Инкубировали при комнатной температуре в течение 20 минут, после чего добавляли 100 мкл сферопластного буфера и 100 мкл воды, перемешивали  и инкубировали 10 минут. Добавляли равный объем водного раствора тритон Х-100 (0.2%) и инкубировали в течение часа при комнатной температуре. Клеточную суспензию трижды замораживали при -20 С и размораживали при комнатной температуре. Центрифугировали при 12000g в течение 3 минут. Супернатант представлял собой фракцию растворимых белков, а осадок — фрацию нерастворимых белков. Осадок ресуспендировали в 100 мкл сферопластного буфера с добавлением тритона Х-100 до конечной концентрации 0,1%.

 Выделение мембранной фракции E. coli.

 Центрифугировали 20 мл культуральной среды при 12000g в течение 10 минут. Клетки суспендировать в 2 мл сферопластного буфера, добавляли 400 мкл лизоцима (2мг/мл), растворенного в том же буфере. Суспензию инкубировали при комнатной температуре 30 минут, после чего добавляли 18 мл сферопластного буфера, 20 мкл 0.1 М PMSF, 40 мкл 0.5 М ЕDТА. Обрабатывали образец ультразвуком (30 kHz) в течение 20 минут. Клеточный дебрис отделяли центрифугированием в течение 30 минут при 6000g. Мембранную фракцию осаждали центрифугированием при 100000g в течение 2 часов.

Анализ белковых препаратов на всех этапах очистки, проверки чистоты препаратов осуществляли с помошью электрофореза в 14% трис-глициновом полиакриламидном геле по Лэммли.

Мембранная фракция была использована для металл-хелат аффинной хроматографии (МХАХ).  Регенерированную смолу наносили (Sepharose helating Ni) наносили на колонки (объем колонки 10 мл, смолы 2 мл). Колонки промывали 6 мл воды и 6 мл буера А (Табл. 4). Пропускали солюбилизированную мембранную фракцию через колонки. Колонки промывали 4 мл буфера А. Элюат собирали в отдельные пробирки. Последовательно промывали и собирали элюат 6 мл буфера В, 6 мл буфера и 3 мл буфера С. Для солюбилизации белков а также поддержания белков в растворимом виде  использовали ионный детергент лаурилсаркозил.

Таблица 2. Состав буферов, исполизуемые в МХАХ.

Компоненты

Буфер А

Буфер В

Буфер С

Tris-HCl, pH 8.0

20 мМ

20 мМ

0

Tris-HCl, pH 7.5

0

0

50 мМ

Глицерин

5%

5%

5%

NaCl

0,5 М

1 М

130 мМ

β-меркаптоэтанол

10 мМ

5 мМ

10 мМ

Имидазол

10 мМ

50 мМ

500 мМ

PMSF

2 мМ

2 мМ

2 мМ

Лаурилсаркозин

1,5%

1%

0,5%

Для солюбилизации белков а также поддержания белков в растворимом виде  использовали ионный детергент лаурилсаркозил. Диализ белков проводили с помощью диализных мембран имеющих размер отсечки 3 кДа. Диализ проводили против буфера (20 мМ Tris-HCl, pH 8.0; 14.6 мМ лаурилсаркозин; 10% глицерин; 50 мМ NaCl).

С целью подтверждения того, что произошла экспрессия целевого белка,   проводили Вестерн-блот.

Способность связывания модифицированных белков с антителами определяли с помощью твердофазного иммуноферментного анализа. Для ориентации первичных антител на поверхность плашки наносили инсулин. Остаточную сорбцию блокировали 1,5%-ным раствором БСА в PBST буфере.  После забивки поверхности добавляли мышиные моноклональные антитела против инсулина челвека. Белки суспендировали в буфере (20 мM Трис-HCl, pH=8,0), содержащем БСА (1 мг/мл), наносили на сорбционную поверхность с заданными разведениями. Количество связавшегося лиганда определяли моноклональными антителами против гистидина, система детекции пероксид водорода – пероксидаза  хрена. В качестве положительного контроля и калибровочной кривой использовали АКТГ-V5 с максимальной концентрацией 200 нг. Отрицательными контролями служили мембранные фракции исходного штамма.

 




1. Человек. 2.Понятие философской антропологии некоторые особенности ее становления и развития
2. Экономика отрасли строительства для студентов специальности 29
3. Малокровие анемия ~ заболевание характеризующееся снижением содержания эритроцитов или гемоглобина
4. ЛАБОРАТОРНАЯ РАБОТА 4 Исследование системы электропривода магнитный усилительасинхронный двигатель с
5. Лекция 12 Инфекционная заболеваемость людей сельскохозяйственных животных поражен
6. ЛЕКЦИЯ 4 БИОТЕХНОЛОГИЯ ВИНОДЕЛИЯ Необходимое условие любого спиртового бродильного процесса наличие
7. Характеристика Роду Сомоподібні (Siluriformes)
8. МОДУЛЬ 2 ОНТОЛОГІЯ Семінар 3 6 неділя ФІЛОСОФС
9. СОЗВЕЗДИЕ ЙОЛДЫЗЛЫК 2014 заполняется печатными буквами Номинация ХОРЕОГРАФИЯ
10. Текстовой процессор Microsoft Word 6.html
11. Печать как способ удостоверения документов
12. Реферат- Современные теории нарушения памяти
13. дипломников Действовать СТРОГО в указанном порядке
14. . Экономика страны характеризуется следующими показателями- общая численность населения 400 млн
15. Вариант 5 Задача 5 Коммерческий банк предлагает сберегательные сертификаты номиналом 500 00000 со сроком пог
16. .koob.ru Когнитивные структуры и интерпретационные процессы Жизнь была бы проще если бы у к
17. Договори про передання результатів інтелектуальної діяльності
18. Аврелий Августин
19. м году. 3Я был тогда хил ходил в телогрейке огромных сапогах и тёмносиних штанах которые мне выделили по ор
20. з курсу загальної фізики передбачає виконання циклів лабораторних робіт із механіки N 1 2 3 4 40 41 43 термодин